ID: 1077306786_1077306792

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1077306786 1077306792
Species Human (GRCh38) Human (GRCh38)
Location 11:1872150-1872172 11:1872171-1872193
Sequence CCTGGTGCATGCTGGTAGAGTTG TGGGGTCTGTCCGGCTGGCGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 2, 3: 10, 4: 138} {0: 4, 1: 6, 2: 0, 3: 10, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!