ID: 1077306885_1077306900

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1077306885 1077306900
Species Human (GRCh38) Human (GRCh38)
Location 11:1872525-1872547 11:1872576-1872598
Sequence CCTGGTGCACGCTGGTAGAGTTG TGGGAGGGGGTGTGTGTGGCAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 2, 3: 7, 4: 90} {0: 3, 1: 5, 2: 11, 3: 175, 4: 1567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!