ID: 1077315999_1077316009

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077315999 1077316009
Species Human (GRCh38) Human (GRCh38)
Location 11:1919625-1919647 11:1919665-1919687
Sequence CCGGCCACCCAGTCACTGGCCAA CAAATGTCACTATAACACGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 246} {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!