ID: 1077404566_1077404579

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1077404566 1077404579
Species Human (GRCh38) Human (GRCh38)
Location 11:2377398-2377420 11:2377425-2377447
Sequence CCCGCGCCCCCGCGCCCCCGCGC TTCTTCGCGCCCCCGCCCCTCGG
Strand - +
Off-target summary {0: 6, 1: 6, 2: 31, 3: 276, 4: 1575} {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!