ID: 1077410869_1077410878

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1077410869 1077410878
Species Human (GRCh38) Human (GRCh38)
Location 11:2403345-2403367 11:2403377-2403399
Sequence CCAGGCAGGGGCGGCCTTGGGAA AGACAGGGGCGAGGGCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 341} {0: 1, 1: 1, 2: 5, 3: 39, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!