ID: 1077424883_1077424890

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1077424883 1077424890
Species Human (GRCh38) Human (GRCh38)
Location 11:2470639-2470661 11:2470665-2470687
Sequence CCTGAACTCAGCTTCCAGGGTTT TGGGGTTCCCTCGGCCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 2, 3: 51, 4: 320} {0: 1, 1: 0, 2: 15, 3: 87, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!