ID: 1077440659_1077440664

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1077440659 1077440664
Species Human (GRCh38) Human (GRCh38)
Location 11:2567234-2567256 11:2567268-2567290
Sequence CCCTTTAGTTCACCTTTGGAACT CTGCAAATACAGATGAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 167} {0: 1, 1: 0, 2: 1, 3: 28, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!