ID: 1077447769_1077447779

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1077447769 1077447779
Species Human (GRCh38) Human (GRCh38)
Location 11:2607400-2607422 11:2607424-2607446
Sequence CCTAACCCCCAATGTTGGTATTA GAGGTGAGGCCTTTGGGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150} {0: 1, 1: 0, 2: 36, 3: 125, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!