ID: 1077472425_1077472434

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1077472425 1077472434
Species Human (GRCh38) Human (GRCh38)
Location 11:2770273-2770295 11:2770311-2770333
Sequence CCTGGCACAGGCAGCCCTGGGCA GTGAGGGGAATGAGAGCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 568} {0: 1, 1: 0, 2: 2, 3: 29, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!