ID: 1077483013_1077483029

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1077483013 1077483029
Species Human (GRCh38) Human (GRCh38)
Location 11:2825348-2825370 11:2825398-2825420
Sequence CCTGCTCAGCTCAGTGTCCTTCC GTGCCAGGGGCCCCGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 275} {0: 1, 1: 0, 2: 1, 3: 42, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!