ID: 1077486684_1077486694

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1077486684 1077486694
Species Human (GRCh38) Human (GRCh38)
Location 11:2841931-2841953 11:2841956-2841978
Sequence CCAGGCAGCGGCAGCCCCAGGAA GTGTTGGGGTGGAGCTGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 410} {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!