ID: 1077495327_1077495334

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1077495327 1077495334
Species Human (GRCh38) Human (GRCh38)
Location 11:2884385-2884407 11:2884398-2884420
Sequence CCCGGCCGCGCCCGGGGAGGGGC GGGGAGGGGCTCCCGCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 498} {0: 1, 1: 0, 2: 8, 3: 56, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!