ID: 1077495327_1077495335

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1077495327 1077495335
Species Human (GRCh38) Human (GRCh38)
Location 11:2884385-2884407 11:2884399-2884421
Sequence CCCGGCCGCGCCCGGGGAGGGGC GGGAGGGGCTCCCGCGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 498} {0: 1, 1: 0, 2: 3, 3: 52, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!