ID: 1077495329_1077495347

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1077495329 1077495347
Species Human (GRCh38) Human (GRCh38)
Location 11:2884390-2884412 11:2884433-2884455
Sequence CCGCGCCCGGGGAGGGGCTCCCG GCTCCCGGGGGGTCGCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 348} {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!