ID: 1077497300_1077497304

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1077497300 1077497304
Species Human (GRCh38) Human (GRCh38)
Location 11:2892433-2892455 11:2892455-2892477
Sequence CCCTCGGATCTGGGGGTGGGGCG GGTGTCACTCGCACCTCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 164} {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!