ID: 1077530527_1077530533

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1077530527 1077530533
Species Human (GRCh38) Human (GRCh38)
Location 11:3092744-3092766 11:3092759-3092781
Sequence CCACCGACTCCTCCAGGGGACAG GGGGACAGGCTGAAGGTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197} {0: 1, 1: 1, 2: 5, 3: 86, 4: 658}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!