ID: 1077530667_1077530682

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1077530667 1077530682
Species Human (GRCh38) Human (GRCh38)
Location 11:3093365-3093387 11:3093412-3093434
Sequence CCTTTCCAGGACACGTGATCTGC CTCCCTGCCAGGGACATCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119} {0: 1, 1: 1, 2: 0, 3: 35, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!