ID: 1077535410_1077535423

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1077535410 1077535423
Species Human (GRCh38) Human (GRCh38)
Location 11:3121785-3121807 11:3121836-3121858
Sequence CCTAATTCCTACCACTGGTGTCC AAGGAAAGGCCTCATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 256} {0: 1, 1: 0, 2: 5, 3: 49, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!