ID: 1077535412_1077535423

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077535412 1077535423
Species Human (GRCh38) Human (GRCh38)
Location 11:3121796-3121818 11:3121836-3121858
Sequence CCACTGGTGTCCTTATAAAAAGG AAGGAAAGGCCTCATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 8, 3: 28, 4: 169} {0: 1, 1: 0, 2: 5, 3: 49, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!