ID: 1077543056_1077543067

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1077543056 1077543067
Species Human (GRCh38) Human (GRCh38)
Location 11:3156746-3156768 11:3156774-3156796
Sequence CCCCTCCCTGCTCTGAGAGCCCA CTTCCACACAGGCCGAGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 561} {0: 1, 1: 0, 2: 3, 3: 19, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!