ID: 1077543060_1077543067

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1077543060 1077543067
Species Human (GRCh38) Human (GRCh38)
Location 11:3156752-3156774 11:3156774-3156796
Sequence CCTGCTCTGAGAGCCCATGCCAC CTTCCACACAGGCCGAGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 259} {0: 1, 1: 0, 2: 3, 3: 19, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!