ID: 1077544169_1077544179

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1077544169 1077544179
Species Human (GRCh38) Human (GRCh38)
Location 11:3161934-3161956 11:3161954-3161976
Sequence CCGGGGCTGACGCCAGACCCCTG CTGTGAGCAAGGAGGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 1466} {0: 1, 1: 0, 2: 6, 3: 70, 4: 658}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!