ID: 1077634749_1077634758

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1077634749 1077634758
Species Human (GRCh38) Human (GRCh38)
Location 11:3834766-3834788 11:3834809-3834831
Sequence CCCAACTGGGAGTGGGGGAGGGG TAGGCGAGTATGGAGGTGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 64, 4: 505} {0: 1, 1: 0, 2: 2, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!