ID: 1077722597_1077722601

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1077722597 1077722601
Species Human (GRCh38) Human (GRCh38)
Location 11:4643452-4643474 11:4643470-4643492
Sequence CCCCCAAATGAGAGAAGGGAGGA GAGGACAGAAAGAACACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 305} {0: 1, 1: 0, 2: 4, 3: 30, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!