ID: 1077789636_1077789646

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077789636 1077789646
Species Human (GRCh38) Human (GRCh38)
Location 11:5424511-5424533 11:5424551-5424573
Sequence CCCTCCATCCTCCCAGTACACAG AGAATCAGTCAGGAAAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 365} {0: 1, 1: 8, 2: 27, 3: 70, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!