ID: 1077866843_1077866849

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1077866843 1077866849
Species Human (GRCh38) Human (GRCh38)
Location 11:6229473-6229495 11:6229511-6229533
Sequence CCTGCTCTGATGTGTCCATCCTT TACCTCAGTCAGCTGAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 199} {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!