ID: 1077887866_1077887875

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1077887866 1077887875
Species Human (GRCh38) Human (GRCh38)
Location 11:6399425-6399447 11:6399473-6399495
Sequence CCAGAAGGTCCAACAGCCAGGAA CCACATCGAACCAATCACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 245} {0: 1, 1: 0, 2: 1, 3: 11, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!