ID: 1077889766_1077889773

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1077889766 1077889773
Species Human (GRCh38) Human (GRCh38)
Location 11:6410755-6410777 11:6410780-6410802
Sequence CCATCTGTAAGGGCTTGGGGCCT GAGGGGCCTCCACACTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132} {0: 1, 1: 0, 2: 5, 3: 19, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!