ID: 1077889766_1077889782

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1077889766 1077889782
Species Human (GRCh38) Human (GRCh38)
Location 11:6410755-6410777 11:6410799-6410821
Sequence CCATCTGTAAGGGCTTGGGGCCT CAGGGGCTCAGGCAGCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132} {0: 1, 1: 0, 2: 6, 3: 71, 4: 680}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!