ID: 1077892945_1077892954

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1077892945 1077892954
Species Human (GRCh38) Human (GRCh38)
Location 11:6432382-6432404 11:6432432-6432454
Sequence CCACTTCTACTGAATGTTCTCAC ATGAGGTGGTGGAAGAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 178} {0: 1, 1: 0, 2: 6, 3: 50, 4: 581}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!