ID: 1077895862_1077895869

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1077895862 1077895869
Species Human (GRCh38) Human (GRCh38)
Location 11:6452775-6452797 11:6452804-6452826
Sequence CCCTCCAGTTTGAGCAGCTCAGG CTCAATACTGATGAGGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 256} {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!