ID: 1077945359_1077945367

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1077945359 1077945367
Species Human (GRCh38) Human (GRCh38)
Location 11:6891586-6891608 11:6891637-6891659
Sequence CCTTGTGGCTACTTTCCTCAGAG ATAGATGAGGGGATTAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 183} {0: 1, 1: 1, 2: 9, 3: 50, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!