ID: 1077948291_1077948296

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1077948291 1077948296
Species Human (GRCh38) Human (GRCh38)
Location 11:6926500-6926522 11:6926547-6926569
Sequence CCACAGCTGGTGCGCGTGCGCAA CAATTTATGAAACTCGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48} {0: 1, 1: 0, 2: 0, 3: 7, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!