ID: 1077988390_1077988397

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1077988390 1077988397
Species Human (GRCh38) Human (GRCh38)
Location 11:7378511-7378533 11:7378557-7378579
Sequence CCAAGTACTAAGCTCTAAGAGTT CAGTTGATGGAGATGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 81} {0: 1, 1: 0, 2: 4, 3: 32, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!