ID: 1078003345_1078003359

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1078003345 1078003359
Species Human (GRCh38) Human (GRCh38)
Location 11:7514361-7514383 11:7514411-7514433
Sequence CCCAACCCTGCCTGGGATCCGCG CGTGGCCCTGGAGATGCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114} {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!