ID: 1078012556_1078012562

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1078012556 1078012562
Species Human (GRCh38) Human (GRCh38)
Location 11:7584110-7584132 11:7584128-7584150
Sequence CCTTATTCCCTGTAATACTACAG TACAGAGCTTTTTAAGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215} {0: 1, 1: 0, 2: 2, 3: 25, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!