|
Left Crispr |
Right Crispr |
Crispr ID |
1078014560 |
1078014565 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:7601967-7601989
|
11:7601990-7602012
|
Sequence |
CCTGTAATCCCAGCTACTTGGGA |
GGCTGAGTCAGGAGAATCGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 48553, 1: 142115, 2: 242012, 3: 520212, 4: 384467} |
{0: 17, 1: 1455, 2: 4893, 3: 4391, 4: 3721} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|