ID: 1078015535_1078015540

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1078015535 1078015540
Species Human (GRCh38) Human (GRCh38)
Location 11:7610444-7610466 11:7610488-7610510
Sequence CCTAAGCTCAGACCTGGGAAGGC CATCTGGTCAACTCCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 228} {0: 1, 1: 0, 2: 1, 3: 18, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!