ID: 1078062605_1078062610

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1078062605 1078062610
Species Human (GRCh38) Human (GRCh38)
Location 11:8057726-8057748 11:8057773-8057795
Sequence CCAATAAAACTTGTTTAACCTTA CATTATTTTGTCATGCTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 70, 3: 120, 4: 340} {0: 38, 1: 70, 2: 77, 3: 122, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!