ID: 1078062605_1078062611

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1078062605 1078062611
Species Human (GRCh38) Human (GRCh38)
Location 11:8057726-8057748 11:8057779-8057801
Sequence CCAATAAAACTTGTTTAACCTTA TTTGTCATGCTTTAAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 70, 3: 120, 4: 340} {0: 61, 1: 94, 2: 97, 3: 78, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!