|
Left Crispr |
Right Crispr |
Crispr ID |
1078062608 |
1078062617 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:8057756-8057778
|
11:8057805-8057827
|
Sequence |
CCTGTTAAGAATTCCTTCATTAT |
GGCCTAGGCAAAACTCTTGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 70, 1: 101, 2: 99, 3: 77, 4: 240} |
{0: 67, 1: 122, 2: 108, 3: 71, 4: 110} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|