ID: 1078065724_1078065735

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1078065724 1078065735
Species Human (GRCh38) Human (GRCh38)
Location 11:8078100-8078122 11:8078128-8078150
Sequence CCTTCTTCCCTGGGTGAACTGAT TTGGGAGAGGGGGTGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202} {0: 1, 1: 0, 2: 8, 3: 41, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!