ID: 1078084403_1078084415

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1078084403 1078084415
Species Human (GRCh38) Human (GRCh38)
Location 11:8225050-8225072 11:8225100-8225122
Sequence CCCCAGTCCCAGAGAGGGAGAAA GTGGGGAGACAGATGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 356} {0: 1, 1: 1, 2: 7, 3: 89, 4: 888}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!