ID: 1078090986_1078090997

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1078090986 1078090997
Species Human (GRCh38) Human (GRCh38)
Location 11:8264531-8264553 11:8264564-8264586
Sequence CCCTGCTTCTCCCCAGAATCCTG TCTGGCTGCCTACCCTAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 441} {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!