ID: 1078119351_1078119358

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1078119351 1078119358
Species Human (GRCh38) Human (GRCh38)
Location 11:8490537-8490559 11:8490579-8490601
Sequence CCCCGTCTCACAGCTGTGAAGAG TGGTGTTTGAGCTCTGAGAACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 98, 3: 4816, 4: 2027} {0: 100, 1: 160, 2: 491, 3: 542, 4: 926}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!