ID: 1078164637_1078164642

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1078164637 1078164642
Species Human (GRCh38) Human (GRCh38)
Location 11:8871327-8871349 11:8871341-8871363
Sequence CCCTCACCTCCTCACCATCCGAC CCATCCGACCAAGAGTTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 308} {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!