ID: 1078355555_1078355565

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1078355555 1078355565
Species Human (GRCh38) Human (GRCh38)
Location 11:10629333-10629355 11:10629361-10629383
Sequence CCCCAGAGGGCCTAGGATCCTTC ACCCACAGAGATCAAGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132} {0: 1, 1: 0, 2: 4, 3: 48, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!