ID: 1078355727_1078355735

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1078355727 1078355735
Species Human (GRCh38) Human (GRCh38)
Location 11:10630134-10630156 11:10630168-10630190
Sequence CCACCTTCCCTCCAGTCACATTG TTTCTCCAAAACTGCCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 413} {0: 2, 1: 1, 2: 0, 3: 18, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!