ID: 1078363555_1078363563

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1078363555 1078363563
Species Human (GRCh38) Human (GRCh38)
Location 11:10688669-10688691 11:10688712-10688734
Sequence CCTGCACTCACCAATACCTGGAT CGATTTCCACCAAGCCGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125} {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!