ID: 1078443538_1078443539

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1078443538 1078443539
Species Human (GRCh38) Human (GRCh38)
Location 11:11387098-11387120 11:11387111-11387133
Sequence CCATAACACAAGGATGTAAATGC ATGTAAATGCAGTCTGAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 168} {0: 1, 1: 0, 2: 1, 3: 23, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!